A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z  1  2  3  4  5  *
CHEMICAL products beginning with : D
33501 to 33550 of 36937 results  Page: << Previous 50 Results 660 661 662 663 664 665 666 667 668 669 670 [671] 672 673 674 675 676 677 678 679 680 >> Next 50 Results
 PRODUCT NAMECAS Registry Number 
DNA (XENOPUS TROPICALIS CLONE TTBA021N19 EST (EXPRESSED SEQUENCE TAG)) (4 suppliers)703560-90-1
Dna antibodies (1 supplier)
DNA LIGASE (13 suppliers)9015-85-4
DNA ligase IV inhibitor (19 suppliers)
Compound Structure IUPAC Name: 5-(benzylideneamino)-6-[(E)-benzylideneamino]-2-sulfanylidene-1H-pyrimidin-4-one | CAS Registry Number: 1533426-72-0
Synonyms: SCR7, SCHEMBL15546668, QC-11823, S7742,1533426-72-0

Molecular Formula: C18H14N4OSMolecular Weight: 334.394960 [g/mol]
H-Bond Donor: 2H-Bond Acceptor: 4

InChIKey: NEEVCWPRIZJJRJ-LWRDCAMISA-N

1533426-72-0
DNA Markers (1 supplier)
DNA polymerase (25 suppliers)9012-90-2
DNA STRAND TRANSFER PROTEIN ALPHA (6 suppliers)137750-51-7
DNA Transcription Inhibitory Peptide (2 suppliers)287956-71-2
DNA(Branchiostoma floridae clone MPMGp498N0544 EST (expressed sequence tag)) (9CI) (6 suppliers)523341-81-3
DNA(Canis familiaris strain Standard Poodle clone tigr-gss-dog-17000330845824genome survey sequence) (9CI) (6 suppliers)605577-38-6
DNA(Canis familiaris strain Standard Poodle clone tigr-gss-dog-17000369549922genome survey sequence) (9CI) (7 suppliers)605177-38-6
DNA(Locusta migratoria clone LM_GL5_003983 EST (expressed sequence tag)) (9CI) (4 suppliers)795117-38-3
DNA(Pinus taeda clone PIAAD57 EST (expressed sequence tag)) (6 suppliers)686602-89-1
DNA, D(P-THIO) (C-T-A-G-A-T-T-T-C-C-C-G-C-G), TRIDE (7 suppliers)362543-73-5
DNA, D(P-THIO) (G-A-T-C-C-G-C-G-G-G-A-A-A-T), TRIDE (5 suppliers)744239-10-9
DNA, D(P-THIO)(C-T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C-T) (8 suppliers)
Compound Structure Synonyms: Trecovirsen, Trecovirsen sodium, Trecovirsen [INN], GEM 91, GEM91, Trecovirsen sodium [USAN], Gene expression modulator 91, AIDS029878, AIDS-029878, LS-59476, 170274-79-0, Deoxyribonucleic acid, d(P-thio)(T-C-T-T-C-C-T-C-T-C-T-C-T-A-C-C-C-A-C-G-C-T-C-T-C), tetracosasodium salt, d(P-Thio)(C-T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C-T)-DNA, Deoxyribonucleic acid, d(P-thio)(C-T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C-T)-, DNA, d(P-thio)(C-T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C-T)-, 148998-94-1, 5'-C spT spC spT spC spG spC spA spC spC spC spA spT spC spT spC spT spC spC spT spT spC spT-3', Deoxyribonucleic acid d(P-thio)(T-C-T-T-C-C-T-C-T-C-T-C-T-A-C-C-C-A-C-G-C-T-C-T-C), tetracosasodium salt, Deoxyribonucleic acid, d (P-thio) (C-T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C-T), tetracosasodium salt

Molecular Formula: C237H310N72O131P24S24Molecular Weight: 7776.331364 [g/mol]
H-Bond Donor: 51H-Bond Acceptor: 155

InChIKey: MTLZEBXFKNNOHO-UHFFFAOYSA-N

153021-75-1
DNA, D(P-THIO)(RGM-RCM-RGM-RUM-G-C-C-T-C-C-T-C-A-C-RUM-RGM-RGM-RCM) (9CI) (8 suppliers)255810-66-3
DNA, D(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(HYDROGEN OCTADECYLPHOSPHORAMIDATE) (4 suppliers)
Compound Structure Synonyms: Octadecamine oligonucleotide, AIDS003065, AIDS-003065, Octadecamine oligonucleotide(pTGGCGTACTCACCAGTCGCCGC), DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(hydrogen octadecylphosphoramidate)

Molecular Formula: C229H307N81O133P22Molecular Weight: 7003.773522 [g/mol]
H-Bond Donor: 52H-Bond Acceptor: 173

InChIKey: OLAPHMFMQDYFCB-UHFFFAOYSA-N

130237-40-0
DNA, D(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[HYDROGEN (2-AMINOPROPYL)PHOSPHORAMIDATE] (4 suppliers)
Compound Structure Synonyms: 2NH2(C3) oligonucleotide, AIDS003066, AIDS-003066, 1,2-Diaminopropane oligonucleotide(pTGGCGTACTCACCAGTCGCCGC), DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(hydrogen (2-aminopropyl)phosphoramidate), DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[hydrogen (2-aminopropyl)phosphoramidate]

Molecular Formula: C214H278N82O133P22Molecular Weight: 6808.389462 [g/mol]
H-Bond Donor: 53H-Bond Acceptor: 174

InChIKey: JLAQMYUBJFVBIC-UHFFFAOYSA-N

130237-37-5
DNA, D(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[HYDROGEN [[4-[(2-CHLOROETHYL)METHYLAMINO]PHENYL]METHYL]PHOSPHORAMIDATE] (4 suppliers)
Compound Structure Synonyms: MeClEtNBzNH2 oligonucleotide, AIDS003067, AIDS-003067, 4-(N-Methyl-N-(2-chloroethyl)amino)-benzylamine oligonucleotide(pTGGCGTACTCACCAGTCGCCGC), DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(hydrogen ((4-((2-chloroethyl)methylamino)phenyl)methyl)phosphoramidate), DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[hydrogen [[4-[(2-chloroethyl)methylamino]phenyl]methyl]phosphoramidate]

Molecular Formula: C221H283ClN82O133P22Molecular Weight: 6932.957062 [g/mol]
H-Bond Donor: 52H-Bond Acceptor: 174

InChIKey: JIRSDPVQSNHPTH-UHFFFAOYSA-N

130237-39-7
DNA, d(T-sp-C-G-sp-T-sp-C-G-sp-T-sp-T-sp-T-sp-T-sp-G-sp-A-sp-C-G-sp-T-sp-T-sp-T-sp-T-sp-G-sp-T-sp-C-G-sp-T-sp-T) (9CI) (1 supplier)665058-78-6
DNA, E. coli (2 suppliers)933845-16-8
DNA,d(A-C-C-G-A-T-A-C-C-G-G-T-G-C-C-G-G-T-G-A-C-G) (9CI) (1 supplier)162165-09-5
DNA,d(C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A), 5'-ester with1,2-ethanediylbis(oxy-2,1-ethanediyl)bis[2-(21,21-dihydroxy-21-oxido-4,11-dioxo-20-oxa-13-thia-3,10-diaza-21-phosphaheneicos-1-yl)-23,23-dihydroxy-23-oxido-6,13-dioxo-22-oxa-15-thia-2,5,12-triaz (5 suppliers)167362-48-3
DNA,d(dmt-T-G-G-G-A-G-G-T-G-G-G-T-C-T-G) (9CI) (1 supplier)153021-65-9
DNA,d(G-C-A-T-G-A-C-G-T-T-G-A-GC) (1 supplier)200219-55-2
DNA,d(G-C-C-G-A-G-G-T-C-C-A-T-G-T-C-G-T-A-C-G-C) (9CI) (1 supplier)138674-42-7
DNA,d(G-C-T-G-C-C-T-C-C-C-G-T-A-G-G-A-G-T) (1 supplier)128906-70-7
DNA,d(G-G-T-C-T-C-G-A-T-G-A-T-C-T-G-A-C-C-T-C-G-T-G-A) (9CI) (3 suppliers)765117-38-2
DNA,d(G-sp-G-G-T-G-G-G-T-G-G-G-T-G-G-G-sp-T) (9CI) (1 supplier)187890-51-3
DNA,d(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A) (9CI) (1 supplier)163665-40-5
DNA,d(P-thio)([2'-O-[6-[[[[(3b)-cholest-5-en-3-yl]oxy]carbonyl]amino]hexyl]]rU-G-C-A-T-C-C-C-C-C-A-G-G-C-C-A-C-C-A-T)(9CI) (1 supplier)166875-00-9
DNA,d(P-thio)([5'-deoxy-5'-(octadecylamino)]T-G-C-A-T-C-C-C-C-C-A-G-G-C-C-A-C-C-A-T)(9CI) (1 supplier)177968-48-8
DNA,d(P-thio)(A-A-G-A-G-A-G-A-G-A-C-C-C-T-G-A-A-C-A-G) (9CI) (1 supplier)151879-85-5
DNA,d(P-thio)(A-G-C-C-G-T-G-G-C-C-T-T-A-A-A-A-T-T-T-T) (9CI) (1 supplier)151879-83-3
DNA,d(P-thio)(A-T-G-G-G-G-T-G-C-A-C-A-A-A-C-T-G-G-G-G) (9CI) (1 supplier)151879-87-7
DNA,d(P-thio)(A-T-T-T-T-C-A-G-G-C-C-T-C-C-A-T-A-T-G-G) (9CI) (1 supplier)151879-84-4
DNA,d(P-thio)(C-A-C-T-G-C-G-G-G-G-A-G-G-G-C-T-G-G-G-G) (9CI) (1 supplier)151879-82-2
DNA,d(P-thio)(C-A-G-C-C-A-T-G-G-T-T-C-C-C-C-C-C-A-A-C) (9CI) (1 supplier)160676-03-9
DNA,d(P-thio)(C-C-A-C-A-C-C-G-A-C-G-G-C-G-C-C-C) (9CI) (1 supplier)149594-04-7
DNA,d(P-thio)(C-C-C-C-A-A-C-C-A-C-C-T-C-T-T-G-C-T-C-C) (9CI) (1 supplier)151879-72-0
DNA,d(P-thio)(C-C-C-G-G-G-A-A-A-A-C-G-T-C-A-G-C-C-A-T) (9CI) (1 supplier)151879-77-5
DNA,d(P-thio)(C-G-C-C-G-T-G-G-A-G-T-C-G-T-T-G-C-C-C-G) (9CI) (1 supplier)151879-89-9
DNA,d(P-thio)(G-A-T-A-A-T-G-T-T-C-T-T-G-G-T-T-G-T-A-A) (9CI) (1 supplier)151879-86-6
DNA,d(P-thio)(G-C-A-G-A-G-G-C-T-G-G-G-G-A-C-A-T-T-G-A) (9CI) (1 supplier)151879-80-0
DNA,d(P-thio)(G-C-A-T-G-A-C-G-T-T-G-A-G-C) (9CI) (1 supplier)200221-73-4
DNA,d(P-thio)(G-C-C-G-A-G-G-T-C-C-A-T-G-T-C-G-T-A-C-G-C) (9CI) (1 supplier)141442-28-6
DNA,d(P-thio)(G-C-G-T-T-T-G-C-T-C-T-T-C-T-T-C-T-T-G-C-G), eicosasodium salt (6 suppliers)160369-77-7
DNA,d(P-thio)(G-G-A-T-T-C-A-C-T-T-C-C-A-C-T-G-C-G-G-G) (9CI) (1 supplier)151879-75-3
DNA,d(P-thio)(G-G-G-A-C-T-C-C-T-C-G-C-T-A-C-T-G-C-C-T) (9CI) (1 supplier)149957-14-2
33501 to 33550 of 36937 results  Page: << Previous 50 Results 660 661 662 663 664 665 666 667 668 669 670 [671] 672 673 674 675 676 677 678 679 680 >> Next 50 Results
Alphabetical Products   |   ALL 20,000 Suppliers
HomeBuyAdd FREE ListingAdvertise Chemical Company