Skype
A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z  1  2  3  4  5  *
CHEMICAL products beginning with : D
35001 to 35050 of 38550 results  Page: << Previous 50 Results 700 [701] 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 >> Next 50 Results
 PRODUCT NAMECAS Registry Number 
DNA,d(P-thio)(G-A-T-A-A-T-G-T-T-C-T-T-G-G-T-T-G-T-A-A) (9CI) (0 suppliers)151879-86-6
DNA,d(P-thio)(G-C-A-G-A-G-G-C-T-G-G-G-G-A-C-A-T-T-G-A) (9CI) (0 suppliers)151879-80-0
DNA,d(P-thio)(G-C-A-T-G-A-C-G-T-T-G-A-G-C) (9CI) (0 suppliers)200221-73-4
DNA,d(P-thio)(G-C-C-G-A-G-G-T-C-C-A-T-G-T-C-G-T-A-C-G-C) (9CI) (0 suppliers)141442-28-6
DNA,d(P-thio)(G-C-G-T-T-T-G-C-T-C-T-T-C-T-T-C-T-T-G-C-G), eicosasodium salt (2 suppliers)
Compound Structure IUPAC Name: icosasodium;1-[(2~{R},4~{S},5~{R})-5-[[[(2~{R},3~{S},5~{R})-2-[[[(2~{R},3~{S},5~{R})-5-(2-amino-6-oxo-1~{H}-purin-9-yl)-2-[[[(2~{R},3~{S},5~{R})-2-[[[(2~{R},3~{S},5~{R})-2-[[[(2~{R},3~{S},5~{R})-2-[[[(2~{R},3~{S},5~{R})-5-(2-amino-6-oxo-1~{H}-purin-9-yl)-2-[[[(2~{R},3~{S},5~{R})-2-[[[(2~{R},3~{S},5~{R})-5-(2-amino-6-oxo-1~{H}-purin-9-yl)-2-(hydroxymethyl)oxolan-3-yl]oxy-oxidophosphinothioyl]oxymethyl]-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-3-yl]oxy-oxidophosphinothioyl]oxymethyl]oxolan-3-yl]oxy-oxidophosphinothioyl]oxymethyl]-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-3-yl]oxy-oxidophosphinothioyl]oxymethyl]-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-3-yl]oxy-oxidophosphinothioyl]oxymethyl]-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-3-yl]oxy-oxidophosphinothioyl]oxymethyl]oxolan-3-yl]oxy-oxidophosphinothioyl]oxymethyl]-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-3-yl]oxy-oxidophosphinothioyl]oxymethyl]-4-[[(2~{R},3~{S},5~{R})-3-[[(2~{R},3~{S},5~{R})-3-[[(2~{R},3~{S},5~{R})-3-[[(2~{R},3~{S},5~{R})-3-[[(2~{R},3~{S},5~{R})-3-[[(2~{R},3~{S},5~{R})-3-[[(2~{R},3~{S},5~{R})-3-[[(2~{R},3~{S},5~{R})-3-[[(2~{R},3~{S},5~{R})-3-[[(2~{R},3~{S},5~{R})-5-(2-amino-6-oxo-1~{H}-purin-9-yl)-3-[[(2~{R},3~{S},5~{R})-3-[[(2~{R},3~{S},5~{R})-5-(2-amino-6-oxo-1~{H}-purin-9-yl)-3-hydroxyoxolan-2-yl]methoxy-oxidophosphinothioyl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-sulfidophosphoryl]oxyoxolan-2-yl]methoxy-oxidophosphinothioyl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-oxidophosphinothioyl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-oxidophosphinothioyl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-oxidophosphinothioyl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-oxidophosphinothioyl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-oxidophosphinothioyl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-oxidophosphinothioyl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-oxidophosphinothioyl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-oxidophosphinothioyl]oxy-5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-oxidophosphinothioyl]oxyoxolan-2-yl]-5-methylpyrimidine-2,4-dione | CAS Registry Number: 160369-77-7
Synonyms: UNII-3Z6W3S36X5, 3Z6W3S36X5, Fomivirsen sodium, ISIS-2922, Fomivirsen sodium [USAN], Deoxyribonucleic acid d(P-thio)(G-C-G-T-T-T-G-C-T-C-T-T-C-T-T-C-T-T-G-C-G), eicosasodium salt

Molecular Formula: C204H243N63Na20O114P20S20Molecular Weight: 7121.986 [g/mol]
H-Bond Donor: 28H-Bond Acceptor: 144

InChIKey: DLKYYJFLRUUGHJ-SSJCJZGYSA-A

160369-77-7
DNA,d(P-thio)(G-G-A-T-T-C-A-C-T-T-C-C-A-C-T-G-C-G-G-G) (9CI) (0 suppliers)151879-75-3
DNA,d(P-thio)(G-G-G-A-C-T-C-C-T-C-G-C-T-A-C-T-G-C-C-T) (9CI) (0 suppliers)149957-14-2
DNA,d(P-thio)(G-G-G-C-T-G-G-G-G-A-G-G-T-G-T-T-T-G-T-T) (9CI) (0 suppliers)151879-81-1
DNA,d(P-thio)(G-G-G-T-G-G-G-T-A-T-A-G-A-A-G-G-G-C-T-C-C) (9CI) (0 suppliers)160640-16-4
DNA,d(P-thio)(G-m5C-A-T-G-A-m5C-G-T-T-G-A-G-m5C) (9CI) (0 suppliers)200221-76-7
DNA,d(P-thio)(G-T-C-A-G-C-C-A-T-G-G-T-C-C-C-C-C-C-C-C) (9CI) (0 suppliers)151879-88-8
DNA,d(P-thio)(G-T-G-G-T-G-G-G-T-G-G-G-T-G-G-G-T) (9CI) (0 suppliers)
Compound Structure IUPAC Name: [5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[5-(2-amino-6-oxo-1H-purin-9-yl)-3-[[3-hydroxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-sulfanylphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxyoxolan-2-yl]methyl [5-(2-amino-6-oxo-1H-purin-9-yl)-2-[[[5-(2-amino-6-oxo-1H-purin-9-yl)-2-[[[2-[[[5-(2-amino-6-oxo-1H-purin-9-yl)-2-[[[5-(2-amino-6-oxo-1H-purin-9-yl)-2-[[[2-[[[5-(2-amino-6-oxo-1H-purin-9-yl)-2-(hydroxymethyl)oxolan-3-yl]oxy-hydroxyphosphinothioyl]oxymethyl]-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]oxolan-3-yl] hydrogen phosphate | CAS Registry Number: 163703-74-0
Synonyms: DNA, d(P-thio)(G-T-G-G-T-G-G-G-T-G-G-G-T-G-G-G-T), Deoxyribonucleic acid, d(P-thio)(G-T-G-G-T-G-G-G-T-G-G-G-T-G-G-G-T)

Molecular Formula: C170H210N70O103P16S2Molecular Weight: 5441.603792 [g/mol]
H-Bond Donor: 47H-Bond Acceptor: 129

InChIKey: FTRWNHBXCNPGCA-UHFFFAOYSA-N

163703-74-0
DNA,d(P-thio)(T-C-C-C-G-C-C-T-G-TG- A-C-A-T-G-C-A-T-T) (0 suppliers)
Compound Structure Synonyms: ISIS 5132, ISIS 9271, CGP 69846A, DNA, d(P-thio)(T-C-C-C-G-C-C-T-G-T-G-A-C-A-T-G-C-A-T-T), Deoxyribonucleic acid, d(P-thio)(T-C-C-C-G-C-C-T-G-T-G-A-C-A-T-G-C-A-T-T)

Molecular Formula: C193H247N68O102P19S19Molecular Weight: 6349.157158 [g/mol]
H-Bond Donor: 45H-Bond Acceptor: 141

InChIKey: OMEUGRCNAZNQLN-UHFFFAOYSA-N

177075-18-2
DNA,d(P-thio)(T-C-G-T-C-G-C-T-G-T-C-T-C-C-G-C-T-T-C-T-T-C-T-T-G-C-C) (9CI) (0 suppliers)151219-07-7
DNA,d(P-thio)(T-G-C-A-T-C-C-C-C-C-A-G-G-C-C-A-C-C-A-T) (2 suppliers)155362-55-3
DNA,d(P-thio)(T-G-G-A-A-T-C-A-G-A-C-A-C-A-A-G-C-C-G-T) (9CI) (0 suppliers)151879-91-3
DNA,d(T-C-C-C-G-C-C-T-G-T-G-A-C-G-T-C-C-A-T-T) (9CI) (0 suppliers)200219-56-3
DNA,D(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C),5'-[(3SS)-CHOLEST-5-EN-3-YLHYDROGENPHOSPHONATE] (0 suppliers)
Compound Structure Synonyms: Cholesteryl oligonucleotide, Cholesteryl oligonucleotide(pTGGCGTACTCACCAGTCGCCGC), Cholestane, deoxyribonucleic acid deriv., DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-((3beta)-cholest-5-en-3-yl hydrogen phosphate), DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[(3.bETA.)-cholest-5-en-3-yl hydrogen phosphate]

Molecular Formula: C238H314N80O134P22Molecular Weight: 7120.918124 [g/mol]
H-Bond Donor: 51H-Bond Acceptor: 158

InChIKey: QYCQTGCSZHSERP-OIZVNQQKSA-N

136088-27-2
DNA,d(T-T-T-T-T-T-T-T-T-T-T), 5'-(dihydrogen phosphate) (9CI) (0 suppliers)
Compound Structure Synonyms: EINECS 215-063-1, 5'-Thymidylic acid, thymidylyl-(5'.3')-thymidylyl-(5'.3')-thymidylyl-(5'.3')-thymidylyl-(5'.3')-thymidylyl-(5'.3')-thymidylyl-(5'.3')-thymidylyl-(5'.3')-thymidylyl-(5'.3')-thymidylyl-(5'.3')-thymidylyl-(5'.3')-

Molecular Formula: C110H145N22O78P11Molecular Weight: 3364.140282 [g/mol]
H-Bond Donor: 24H-Bond Acceptor: 78

InChIKey: YDHYHGPUJNRYAC-UHFFFAOYSA-N

1278-25-7
DNA-PK Inhibitor IV (0 suppliers)
DNA-PK Inhibitor V (2 suppliers)
Compound Structure IUPAC Name: (2-hydroxy-4-morpholin-4-ylphenyl)-phenylmethanone | CAS Registry Number: 404009-46-7
Synonyms: ArylMorpholine Analog 37, AMA37, 1-(2-Hydroxy-4-morpholin-4-yl-phenyl)-phenyl-methanone, AGN-PC-015JQA, SureCN3210718, AM-A37, CHEMBL478980, CTK8F1026, CHEBI:606618, HMS3229O17, IN1493, CCG-206746, SMP2_000080, BRD-K51018020-001-01-9, Methanone, [2-hydroxy-4-(4-morpholinyl)phenyl]phenyl-

Molecular Formula: C17H17NO3Molecular Weight: 283.321780 [g/mol]
H-Bond Donor: 1H-Bond Acceptor: 4

InChIKey: FALILNHGILFDLC-UHFFFAOYSA-N

404009-46-7
DNA-SPERMIDINE (3 suppliers)37217-88-2
DNA/RNA Synthesis Reagents (2 suppliers)
DNA43 PROTEIN (2 suppliers)147337-70-0
DNA52 PROTEIN (2 suppliers)147337-71-1
DNACIN A(SUB 1) (1 supplier)69913-37-7
Dnacin B1 (0 suppliers)
Compound Structure Synonyms: AC1MJ5IM, LS-63355

Molecular Formula: C19H24N4O5Molecular Weight: 388.417660 [g/mol]
H-Bond Donor: 3H-Bond Acceptor: 9

InChIKey: BJHZMIHVUMIBSL-UHFFFAOYSA-N

76828-84-7
DNACINS (3 suppliers)76828-82-5
DNAM (2 suppliers)1117893-19-2
DNAM CEP (0 suppliers)1117893-10-3
DNCO (2 suppliers)
Compound Structure IUPAC Name: 4-azido-N-[2-[2-(4-azido-2-nitroanilino)ethylsulfonylsulfanyl]ethyl]-2-nitroaniline | CAS Registry Number: 64273-10-5
Synonyms: CID3037773, Di-N-(2-nitro-4-azidophenyl)cystamine-S,S-dioxide, Ethanesulfonothioic acid, 2-((4-azido-2-nitrophenyl)amino)-, S-(2-((4-azido-2-nitrophenyl)amino)ethyl) ester

Molecular Formula: C16H16N10O6S2Molecular Weight: 508.491640 [g/mol]
H-Bond Donor: 2H-Bond Acceptor: 12

InChIKey: BYMZEXPKRSJSSO-UHFFFAOYSA-N

64273-10-5
Dneprolon M (0 suppliers)68850-81-7
DNMT3b2 7a INHIBITOR (0 suppliers)901775-98-2
DNNC (0 suppliers)
Compound Structure IUPAC Name: 1,3,5,5-tetranitro-1,3-diazinane | CAS Registry Number: 81360-42-1
Synonyms: 1,3,5,5-Tetranitrohexahydropyrimidine, 1,1,3,5-Tetranitrohexahydropyrimidine, AC1L3Q8I, 1,3,5,5-tetranitro-1,3-diazinane

Molecular Formula: C4H6N6O8Molecular Weight: 266.125840 [g/mol]
H-Bond Donor: 0H-Bond Acceptor: 10

InChIKey: NOEKJIBAIMWJEB-UHFFFAOYSA-N

81360-42-1
DNOK(9CI) (0 suppliers)12790-66-8
DNP-60502 (1 supplier)
Compound Structure IUPAC Name: 8-[9-[(1R)-4,6-dimethoxy-3-oxo-1H-2-benzofuran-1-yl]nonyl]-3-(2-hydroxyethyl)-1,3,8-triazaspiro[4.5]decane-2,4-dione | CAS Registry Number: 1007399-87-2
Synonyms: UNII-1V7U1OER7Y, 1V7U1OER7Y, 1,3,8-Triazaspiro(4.5)decane-2,4-dione, 8-(9-((1R)-1,3-dihydro-4,6-dimethoxy-3-oxo-1-isobenzofuranyl)nonyl)-3-(2-hydroxyethyl)-

Molecular Formula: C28H41N3O7Molecular Weight: 531.641040 [g/mol]
H-Bond Donor: 2H-Bond Acceptor: 8

InChIKey: SPHZLCCNIAMMKM-JOCHJYFZSA-N

1007399-87-2
DNP-ARG-ASN-ALA-THR-ALA-VAL-NH2 (3 suppliers)
Compound Structure IUPAC Name: 4-methyl-3,5-dinitroaniline | CAS Registry Number: 153919-64-3
Synonyms: 4-Amino-2,6-dinitrotoluene, 19406-51-0, 4-Methyl-3,5-dinitroaniline, Benzenamine, 4-methyl-3,5-dinitro-, p-Toluidine, 3,5-dinitro-, 3,5-Dinitro-4-methylaniline, 3,5-Dinitro-p-toluidine, 4-METHYL-3,5-DINITROBENZENAMINE, 2,6-Dinitro-4-aminotoluene, CCRIS 5190, 4-methyl-3,5-dinitro-phenylamine, Benzenamine, 3,5-dinitro-4-methyl-, NSC 25010, SBB002337, AG-E-41858, BRN 2462150, Benzenamine,5-dinitro-, p-Toluidine,5-dinitro-, AI3-23207, 4-Methyl-3,5-dinitrophenylamine

Molecular Formula: C7H7N3O4Molecular Weight: 197.148180 [g/mol]
H-Bond Donor: 1H-Bond Acceptor: 5

InChIKey: KQRJATLINVYHEZ-UHFFFAOYSA-N

153919-64-3
DNP-ARG-PRO-LEU-ALA-LEU-TRP-ARG-SER-OH (3 suppliers)
Compound Structure IUPAC Name: (2~{S})-2-[[(2~{S})-5-(diaminomethylideneamino)-2-[[(2~{S})-2-[[(2~{S})-2-[[(2~{S})-2-[[(2~{S})-2-[[(2~{S})-1-[(2~{S})-5-(diaminomethylideneamino)-2-(2,4-dinitroanilino)pentanoyl]pyrrolidine-2-carbonyl]amino]-4-methylpentanoyl]amino]propanoyl]amino]-4-methylpentanoyl]amino]-3-(1~{H}-indol-3-yl)propanoyl]amino]pentanoyl]amino]-3-hydroxypropanoic acid | CAS Registry Number: 172666-82-9
Synonyms: Dnp-Arg-Pro-Leu-Ala-Leu-Trp-Arg-Ser, Dnp-Arg-Pro-Leu-Ala-Leu-Trp-Arg-Ser-OH, Dnp-RPLALWRS pound>>Dnp-Arg-Pro-Leu-Ala-Leu-Trp-Arg-Ser-OH pound>>Matrix Metalloproteinase-7 Fluorogenic Substrate pound>>MMP-7 Fluorogenic Substrate

Molecular Formula: C52H77N17O14Molecular Weight: 1164.293 [g/mol]
H-Bond Donor: 14H-Bond Acceptor: 17

InChIKey: QGUMMYMULJJAFN-VMTJQXTBSA-N

172666-82-9
DNp-au-nhs (2 suppliers)
Compound Structure IUPAC Name: (2,5-dioxopyrrolidin-1-yl) 11-(2,4-dinitroanilino)undecanoate | CAS Registry Number: 1864072-86-5
Synonyms: Dnp-au-nhs, MFCD09952652, ZINC252496709

Molecular Formula: C21H28N4O8Molecular Weight: 464.500 [g/mol]
H-Bond Donor: 1H-Bond Acceptor: 9

InChIKey: PPJJPRUNHLLZJD-UHFFFAOYSA-N

1864072-86-5
DNP-DL-ALPHA-AMINO-N-BUTYRIC ACID (4 suppliers)
Compound Structure IUPAC Name: 2-(2,4-dinitroanilino)butanoic acid | CAS Registry Number: 31356-29-3
Synonyms: Oprea1_467031, CBDivE_000920, CHEBI:531545, MolPort-001-837-046, CID2828210, DNP-DL-alpha-AMINO-n-BUTYRIC ACID, 2-(2,4-dinitrophenylamino)butanoic acid, A0505/0023481

Molecular Formula: C10H11N3O6Molecular Weight: 269.210840 [g/mol]
H-Bond Donor: 2H-Bond Acceptor: 7

InChIKey: MPWLEWUMPDWNFL-UHFFFAOYSA-N

31356-29-3
DNP-DL-ASPARTIC ACID (2 suppliers)
Compound Structure IUPAC Name: 2-(2,4-dinitroanilino)-3-sulfopropanoic acid | CAS Registry Number: 81187-95-3
Synonyms: DNP-Cysteic acid sodium salt, NSC638610, AC1L7WHH, AC1Q1ZJF, MCULE-6335510277, alanine, N-(2,4-dinitrophenyl)-3-sulfo-, ST45022127, ST50819538, 2-(2,4-dinitroanilino)-3-sulfopropanoic acid, 2-[(2,4-dinitrophenyl)amino]-3-sulfopropanoic acid, 2-(2,4-Dinitro-phenylamino)-3-sulfo-propionic acid; DNP-Cysteic acid (*sodium salt*)

Molecular Formula: C9H9N3O9SMolecular Weight: 335.247460 [g/mol]
H-Bond Donor: 3H-Bond Acceptor: 10

InChIKey: ZLEWNRPPGPGZJT-UHFFFAOYSA-N

81187-95-3
Dnp-Dl-Methionine Sulfone (5 suppliers)
Compound Structure IUPAC Name: 2-(2,4-dinitroanilino)-4-methylsulfonylbutanoic acid | CAS Registry Number: 16068-18-1
Synonyms: DNP-DL-methionine sulfone, 2-[(2,4-dinitrophenyl)amino]-4-(methylsulfonyl)butanoic acid, ST51037212, N-(2,4-Dinitrophenyl)-DL-methionine sulfone, NSC96406, ACMC-20muyu, AC1Q1ZJB, AGN-PC-002NJR, D0630_SIGMA, AC1L67R9, Butanoic acid, 2-[(2,4-dinitrophenyl)amino]-4-(methylsulfonyl)-, (2S)-, CTK4D0542, 133520-35-1, NSC96407, AR-1D5470, NSC-96406, NSC-96407, 2-(2,4-dinitroanilino)-4-methylsulfonylbutanoic acid, (2S)-2-(2,4-dinitroanilino)-4-methylsulfonylbutanoic acid, Butanoic acid,2-[(2,4-dinitrophenyl)amino]-4-(methylsulfonyl)-

Molecular Formula: C11H13N3O8SMolecular Weight: 347.301220 [g/mol]
H-Bond Donor: 2H-Bond Acceptor: 9

InChIKey: KFPFJKADCNQPPQ-UHFFFAOYSA-N

16068-18-1
Dnp-Dl-Methionine Sulfoxide (6 suppliers)
Compound Structure IUPAC Name: 2-(2,4-dinitroanilino)-4-methylsulfinylbutanoic acid | CAS Registry Number: 1695-02-9
Synonyms: DNP-DL-methionine sulfoxide, D0755_SIGMA, MolPort-003-940-918, EINECS 216-910-8, CID102676, N-(2,4-Dinitrophenyl)-DL-methionine sulfoxide, DL-2-(2,4-Dinitroanilino)-4-(methylsulphinyl)butyric acid

Molecular Formula: C11H13N3O7SMolecular Weight: 331.301820 [g/mol]
H-Bond Donor: 2H-Bond Acceptor: 8

InChIKey: FTOHDWRUZIRPDU-UHFFFAOYSA-N

1695-02-9
DNP-L -PROLYL-L -LEUCYLGLYCINE (2 suppliers)
Compound Structure IUPAC Name: 2-[[(2S)-2-[[(2S)-1-(2,4-dinitrophenyl)pyrrolidine-2-carbonyl]amino]-4-methylpentanoyl]amino]acetic acid | CAS Registry Number: 65985-66-2
Synonyms: EINECS 265-993-7, CID6455226, N-(N-(1-(2,4-Dinitrophenyl)-L-prolyl)-L-leucyl)glycine

Molecular Formula: C19H25N5O8Molecular Weight: 451.430500 [g/mol]
H-Bond Donor: 3H-Bond Acceptor: 9

InChIKey: AKFPJMPDELFVBU-ZFWWWQNUSA-N

65985-66-2
DNP-L-cysteic acid disodium salt hydrate (3 suppliers)
Compound Structure IUPAC Name: disodium;(2R)-2-(2,4-dinitroanilino)-3-sulfonatopropanoate;hydrate | CAS Registry Number: 16068-14-7
Synonyms: N-(2,4-Dinitrophenyl)-L-cysteic acid disodium salt hydrate, D6017_SIGMA

Molecular Formula: C9H9N3Na2O10SMolecular Weight: 397.226399 [g/mol]
H-Bond Donor: 2H-Bond Acceptor: 11

InChIKey: MSLSYEHLHPKCOJ-QTPLPEIMSA-L

16068-14-7
DNp-nh-peg(12)-cooh (3 suppliers)
Compound Structure IUPAC Name: 3-[2-[2-[2-[2-[2-[2-[2-[2-[2-[2-[2-[2-(2,4-dinitroanilino)ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]propanoic acid | CAS Registry Number: 1334178-00-5
Synonyms: DNP-PEG12-acid, Dnp-nh-peg(12)-cooh, AKOS030213543, ZINC169718789, BP-22398, alpha-(2,4-Dinitrophenyl)amino-omega-carboxy dodeca(ethylene glycol)

Molecular Formula: C33H57N3O18Molecular Weight: 783.822 [g/mol]
H-Bond Donor: 2H-Bond Acceptor: 19

InChIKey: NPMXZVXDKCQLJY-UHFFFAOYSA-N

1334178-00-5
DNp-nh-peg(12)-nhs (3 suppliers)
Compound Structure IUPAC Name: (2,5-dioxopyrrolidin-1-yl) 3-[2-[2-[2-[2-[2-[2-[2-[2-[2-[2-[2-[2-(2,4-dinitroanilino)ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]ethoxy]propanoate | CAS Registry Number: 1334178-01-6
Synonyms: Dnp-nh-peg(12)-nhs, DNP-PEG12-NHS ester, AKOS030213544, ZINC169718790, BP-22397, alpha-(2,4-Dinitrophenyl)amino-omega-succinimidyl ester dodeca(ethylene glycol)

Molecular Formula: C37H60N4O20Molecular Weight: 880.895 [g/mol]
H-Bond Donor: 1H-Bond Acceptor: 21

InChIKey: LWMYSNAZTFJPDV-UHFFFAOYSA-N

1334178-01-6
DNP-PEG2-acid (5 suppliers)
Compound Structure IUPAC Name: 3-[2-[2-(2,4-dinitroanilino)ethoxy]ethoxy]propanoic acid | CAS Registry Number: 1353011-89-8
Synonyms: BIPG1382, ZINC79016551, BP-20563

Molecular Formula: C13H17N3O8Molecular Weight: 343.292 [g/mol]
H-Bond Donor: 2H-Bond Acceptor: 9

InChIKey: ZZALENBFHFRJPM-UHFFFAOYSA-N

1353011-89-8
DNP-PEG3-azide (1 supplier)
Compound Structure IUPAC Name: N-[2-[2-[2-(2-azidoethoxy)ethoxy]ethoxy]ethyl]-2,4-dinitroaniline | CAS Registry Number: 951671-87-7
Synonyms: BP-23248

Molecular Formula: C14H20N6O7Molecular Weight: 384.340 [g/mol]
H-Bond Donor: 1H-Bond Acceptor: 10

InChIKey: FIAOTUUAWJBUBV-UHFFFAOYSA-N

951671-87-7
DNP-PEG3-DNP (4 suppliers)
Compound Structure IUPAC Name: ~{N}-[2-[2-[2-[2-(2,4-dinitroanilino)ethoxy]ethoxy]ethoxy]ethyl]-2,4-dinitroaniline | CAS Registry Number: 1365655-92-0
Synonyms: BIPG1387, ZINC100008560, BP-20581

Molecular Formula: C20H24N6O11Molecular Weight: 524.443 [g/mol]
H-Bond Donor: 2H-Bond Acceptor: 13

InChIKey: DCJHARRKAIYZFB-UHFFFAOYSA-N

1365655-92-0
35001 to 35050 of 38550 results  Page: << Previous 50 Results 700 [701] 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 >> Next 50 Results
Alphabetical Products   |   ALL 20,000 Suppliers
HomeBuyAdd FREE ListingAdvertise Chemical Company