Skype
A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z  1  2  3  4  5  *
CHEMICAL products beginning with : D
35651 to 35700 of 39308 results  Page: << Previous 50 Results 700 701 702 703 704 705 706 707 708 709 710 711 712 713 [714] 715 716 717 718 719 720 >> Next 50 Results
 PRODUCT NAMECAS Registry Number 
DNA (bacteriophage l prmU93 operator oR) (9CI) (0 suppliers)77115-00-5
DNA (cattle gene Ob1 odd homeobox 1 protein cDNA plus flanks) (1 supplier)427801-23-8
DNA (coliphage T7 gene 1.2) 255 (0 suppliers)75603-43-9
DNA (Conus textileprepro-d-conotoxin Tx VIA synthetic geneplus flanks) (9CI) (0 suppliers)161076-82-0
DNA (human adenovirus ONYX-015) (0 suppliers)437981-77-6
DNA (human cloneMR4-ST0098-120100-001-h02 EST (expressed sequence tag)) (9CI) (0 suppliers)380800-00-0
DNA (HUMAN U937 CELL GENE RAC PROTEIN KINASE KINASE CDNA PLUS FLANKS) (3 suppliers)197829-82-6
DNA (methane producing archaea iron corrosivity-related region) (2 suppliers)1242128-23-9
DNA (Oncorhynchusmykiss clone tcay0029.d.02 EST (expressed sequence tag)) (9CI) (1 supplier)
Compound Structure IUPAC Name: 2-methyl-6-nitrobenzoic acid | CAS Registry Number: 513506-76-8
Synonyms: 2-METHYL-6-NITROBENZOIC ACID, 13506-76-8, 6-Nitro-o-toluic acid, 6-Methyl-2-nitrobenzoic acid, Benzoic acid, 2-methyl-6-nitro-, o-Toluic acid, 6-nitro-, 2-methyl-6-nitrobenzoicacid, 2-Methyl-5-nitrobenzoicacid, EINECS 236-833-3, SBB028499, AG-D-71799, ST50406588, NCGC00091581-01, PubChem14045, ACMC-1AYOE, AC1Q2DJL, SureCN33666, 2-Carboxy-3-nitrotoluene, DSSTox_CID_5639, AC1Q2N9D

Molecular Formula: C8H7NO4Molecular Weight: 181.145480 [g/mol]
H-Bond Donor: 1H-Bond Acceptor: 4

InChIKey: CCXSGQZMYLXTOI-UHFFFAOYSA-N

513506-76-8
DNA (peanut clone SGLgalactose-binding lectin C-terminal precursor fragment-specifying plus3'-flank) (9CI) (0 suppliers)168313-29-9
DNA (POPULUS TREMULA X POPULUS TREMULOIDES CLONE A031P74 EST (EXPRESSED SEQUENCE TAG)) (0 suppliers)623231-60-7
DNA (RATTUS NORVEGICUS GENE RAC PROTEIN KINASE KINASE CDNA PLUS FLANKS) (3 suppliers)200678-22-4
DNA (XENOPUS TROPICALIS CLONE TTBA021N19 EST (EXPRESSED SEQUENCE TAG)) (1 supplier)703560-90-1
Dna antibodies (1 supplier)
DNA LIGASE (9 suppliers)9015-85-4
DNA ligase IV inhibitor (11 suppliers)
Compound Structure IUPAC Name: 5-(benzylideneamino)-6-[(E)-benzylideneamino]-2-sulfanylidene-1H-pyrimidin-4-one | CAS Registry Number: 1533426-72-0
Synonyms: SCR7, SCHEMBL15546668, QC-11823, S7742,1533426-72-0

Molecular Formula: C18H14N4OSMolecular Weight: 334.394960 [g/mol]
H-Bond Donor: 2H-Bond Acceptor: 4

InChIKey: NEEVCWPRIZJJRJ-LWRDCAMISA-N

1533426-72-0
DNA Markers (1 supplier)
DNA polymerase (11 suppliers)9012-90-2
DNA STRAND TRANSFER PROTEIN ALPHA (2 suppliers)137750-51-7
DNA Transcription Inhibitory Peptide (1 supplier)
Compound Structure IUPAC Name: (4S)-5-[[(1S)-3-amino-1-carboxy-3-oxopropyl]amino]-4-[[(2S)-4-carboxy-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-3-carboxy-2-[[(2S)-5-oxopyrrolidine-2-carbonyl]amino]propanoyl]amino]propanoyl]amino]-3-phosphonooxypropanoyl]amino]propanoyl]amino]butanoyl]amino]-5-oxopentanoic acid | CAS Registry Number: 287956-71-2

Molecular Formula: C34H48N9O25PMolecular Weight: 1013.770 [g/mol]
H-Bond Donor: 17H-Bond Acceptor: 25

InChIKey: KJWQCILDEHGCBP-YSZCXEEOSA-N

287956-71-2
DNA(Branchiostoma floridae clone MPMGp498N0544 EST (expressed sequence tag)) (9CI) (3 suppliers)523341-81-3
DNA(Canis familiaris strain Standard Poodle clone tigr-gss-dog-17000330845824genome survey sequence) (9CI) (3 suppliers)605577-38-6
DNA(Canis familiaris strain Standard Poodle clone tigr-gss-dog-17000369549922genome survey sequence) (9CI) (4 suppliers)605177-38-6
DNA(Locusta migratoria clone LM_GL5_003983 EST (expressed sequence tag)) (9CI) (3 suppliers)795117-38-3
DNA(Pinus taeda clone PIAAD57 EST (expressed sequence tag)) (2 suppliers)686602-89-1
DNA(Salmon sperm ) (1 supplier)438545-06-3
DNA, D(P-THIO) (C-T-A-G-A-T-T-T-C-C-C-G-C-G), TRIDE (3 suppliers)362543-73-5
DNA, D(P-THIO) (G-A-T-C-C-G-C-G-G-G-A-A-A-T), TRIDE (2 suppliers)744239-10-9
DNA, D(P-THIO)(C-T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C-T) (3 suppliers)
Compound Structure Synonyms: Trecovirsen, Trecovirsen sodium, Trecovirsen [INN], GEM 91, GEM91, Trecovirsen sodium [USAN], Gene expression modulator 91, AIDS029878, AIDS-029878, LS-59476, 170274-79-0, Deoxyribonucleic acid, d(P-thio)(T-C-T-T-C-C-T-C-T-C-T-C-T-A-C-C-C-A-C-G-C-T-C-T-C), tetracosasodium salt, d(P-Thio)(C-T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C-T)-DNA, Deoxyribonucleic acid, d(P-thio)(C-T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C-T)-, DNA, d(P-thio)(C-T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C-T)-, 148998-94-1, 5'-C spT spC spT spC spG spC spA spC spC spC spA spT spC spT spC spT spC spC spT spT spC spT-3', Deoxyribonucleic acid d(P-thio)(T-C-T-T-C-C-T-C-T-C-T-C-T-A-C-C-C-A-C-G-C-T-C-T-C), tetracosasodium salt, Deoxyribonucleic acid, d (P-thio) (C-T-C-T-C-G-C-A-C-C-C-A-T-C-T-C-T-C-T-C-C-T-T-C-T), tetracosasodium salt

Molecular Formula: C237H310N72O131P24S24Molecular Weight: 7776.331364 [g/mol]
H-Bond Donor: 51H-Bond Acceptor: 155

InChIKey: MTLZEBXFKNNOHO-UHFFFAOYSA-N

153021-75-1
DNA, D(P-THIO)(RGM-RCM-RGM-RUM-G-C-C-T-C-C-T-C-A-C-RUM-RGM-RGM-RCM) (9CI) (3 suppliers)255810-66-3
DNA, D(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(HYDROGEN OCTADECYLPHOSPHORAMIDATE) (1 supplier)
Compound Structure Synonyms: Octadecamine oligonucleotide, AIDS003065, AIDS-003065, Octadecamine oligonucleotide(pTGGCGTACTCACCAGTCGCCGC), DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(hydrogen octadecylphosphoramidate)

Molecular Formula: C229H307N81O133P22Molecular Weight: 7003.773522 [g/mol]
H-Bond Donor: 52H-Bond Acceptor: 173

InChIKey: OLAPHMFMQDYFCB-UHFFFAOYSA-N

130237-40-0
DNA, D(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[HYDROGEN (2-AMINOPROPYL)PHOSPHORAMIDATE] (1 supplier)
Compound Structure Synonyms: 2NH2(C3) oligonucleotide, AIDS003066, AIDS-003066, 1,2-Diaminopropane oligonucleotide(pTGGCGTACTCACCAGTCGCCGC), DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(hydrogen (2-aminopropyl)phosphoramidate), DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[hydrogen (2-aminopropyl)phosphoramidate]

Molecular Formula: C214H278N82O133P22Molecular Weight: 6808.389462 [g/mol]
H-Bond Donor: 53H-Bond Acceptor: 174

InChIKey: JLAQMYUBJFVBIC-UHFFFAOYSA-N

130237-37-5
DNA, D(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[HYDROGEN [[4-[(2-CHLOROETHYL)METHYLAMINO]PHENYL]METHYL]PHOSPHORAMIDATE] (1 supplier)
Compound Structure Synonyms: MeClEtNBzNH2 oligonucleotide, AIDS003067, AIDS-003067, 4-(N-Methyl-N-(2-chloroethyl)amino)-benzylamine oligonucleotide(pTGGCGTACTCACCAGTCGCCGC), DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-(hydrogen ((4-((2-chloroethyl)methylamino)phenyl)methyl)phosphoramidate), DNA, d(T-G-G-C-G-T-A-C-T-C-A-C-C-A-G-T-C-G-C-C-G-C), 5'-[hydrogen [[4-[(2-chloroethyl)methylamino]phenyl]methyl]phosphoramidate]

Molecular Formula: C221H283ClN82O133P22Molecular Weight: 6932.957062 [g/mol]
H-Bond Donor: 52H-Bond Acceptor: 174

InChIKey: JIRSDPVQSNHPTH-UHFFFAOYSA-N

130237-39-7
DNA, d(T-sp-C-G-sp-T-sp-C-G-sp-T-sp-T-sp-T-sp-T-sp-G-sp-A-sp-C-G-sp-T-sp-T-sp-T-sp-T-sp-G-sp-T-sp-C-G-sp-T-sp-T) (9CI) (0 suppliers)665058-78-6
DNA, E. coli (2 suppliers)933845-16-8
DNA,d(A-C-C-G-A-T-A-C-C-G-G-T-G-C-C-G-G-T-G-A-C-G) (9CI) (0 suppliers)162165-09-5
DNA,d(C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A-C-A), 5'-ester with1,2-ethanediylbis(oxy-2,1-ethanediyl)bis[2-(21,21-dihydroxy-21-oxido-4,11-dioxo-20-oxa-13-thia-3,10-diaza-21-phosphaheneicos-1-yl)-23,23-dihydroxy-23-oxido-6,13-dioxo-22-oxa-15-thia-2,5,12-triaz (2 suppliers)167362-48-3
DNA,d(dmt-T-G-G-G-A-G-G-T-G-G-G-T-C-T-G) (9CI) (0 suppliers)153021-65-9
DNA,d(G-C-A-T-G-A-C-G-T-T-G-A-GC) (0 suppliers)200219-55-2
DNA,d(G-C-C-G-A-G-G-T-C-C-A-T-G-T-C-G-T-A-C-G-C) (9CI) (0 suppliers)138674-42-7
DNA,d(G-C-T-G-C-C-T-C-C-C-G-T-A-G-G-A-G-T) (0 suppliers)128906-70-7
DNA,d(G-G-T-C-T-C-G-A-T-G-A-T-C-T-G-A-C-C-T-C-G-T-G-A) (9CI) (2 suppliers)765117-38-2
DNA,d(G-sp-G-G-T-G-G-G-T-G-G-G-T-G-G-G-sp-T) (9CI) (0 suppliers)187890-51-3
DNA,d(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A) (9CI) (0 suppliers)163665-40-5
DNA,d(P-thio)([2'-O-[6-[[[[(3b)-cholest-5-en-3-yl]oxy]carbonyl]amino]hexyl]]rU-G-C-A-T-C-C-C-C-C-A-G-G-C-C-A-C-C-A-T)(9CI) (0 suppliers)166875-00-9
DNA,d(P-thio)([5'-deoxy-5'-(octadecylamino)]T-G-C-A-T-C-C-C-C-C-A-G-G-C-C-A-C-C-A-T)(9CI) (0 suppliers)177968-48-8
DNA,d(P-thio)(A-A-G-A-G-A-G-A-G-A-C-C-C-T-G-A-A-C-A-G) (9CI) (0 suppliers)151879-85-5
DNA,d(P-thio)(A-G-C-C-G-T-G-G-C-C-T-T-A-A-A-A-T-T-T-T) (9CI) (0 suppliers)151879-83-3
DNA,d(P-thio)(A-T-G-G-G-G-T-G-C-A-C-A-A-A-C-T-G-G-G-G) (9CI) (0 suppliers)151879-87-7
DNA,d(P-thio)(A-T-T-T-T-C-A-G-G-C-C-T-C-C-A-T-A-T-G-G) (9CI) (0 suppliers)151879-84-4
35651 to 35700 of 39308 results  Page: << Previous 50 Results 700 701 702 703 704 705 706 707 708 709 710 711 712 713 [714] 715 716 717 718 719 720 >> Next 50 Results
Alphabetical Products   |   ALL 20,000 Suppliers
HomeBuyAdd FREE ListingAdvertise Chemical Company